fidelity cas9 coding sequences Search Results


96
New England Biolabs cas9 nuclease
(A) Schematic representation of the mouse and human Tyr loci and the <t>CRISPR/Cas9</t> experimental design of the two RNA guides are represented in the exon 1 sequence. SDE-sgRNAs match the splice site between exon 1 and intron 1–2. IE-sgRNAs target a central position at the coding sequence of exon 1. (B) Schematic representation of the mouse and human ATM loci and the CRISPR/Cas9 experimental design the two RNA guides are represented in the exon 10 sequence. SDE-sgRNAs match the splice site between exon 10 and intron 10–11, and IE-sgRNAs target a coding sequence of exon 10. (C) Schematic representation of the human ABL-1 locus and the CRISPR/Cas9 experimental design the two RNA guides. SDE-sgRNAs match the splice site between exon 4 and intron 4–5, and IE-sgRNAs target a coding sequence of exon 6. Sequences of each SDE-sgRNA are represented (blue line) and its expected cleavage point (blue arrowhead) at the splice donor sequence (red dotted box). Also, several candidates to SDE-sgRNAs are listed with its respective scores (red box correspond to selected sgRNAs).
Cas9 Nuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc06508695-159-12-27?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
cas9 nuclease - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Integrated DNA Technologies cas9 coding sequence
Delivery of the first generation of the two-component lentivector nanoparticles carrying the <t>Cas9</t> nuclease protein and a template for the U6-sgRNA expression cassette (VECTR-Cas(sgGFP)) to human HEK293-EGFP cells. ( A ) Design of the constructs to generate the lentivector particles. Cas9 was fused to the C-terminus of Vpr containing an authentic HIV-1 protease cleavage site (CTLNF/PISPI; Vpr.Prot.Cas9). The U6-sgRNA expression cassette was incorporated into a lentiviral expression vector (Lenti(sgRNA)). The packaging construct (psPAX2) encodes the structural and enzymatic components of virions. The VSV.G envelope protein was used to pseudotype and stabilize viral particles (pHCMV-G). Efficient nuclear export and colocalization of mRNA for translation were supported by adding the Rev-responsive element (RRE) to the constructs and by overexpressing Rev during virion production (pRSV-Rev). Gag-Pol subunits: matrix (MA), capsid (CA), nucleocapsid (NC), p6, protease (PR), reverse transcriptase (RT) and integrase (IN). Packaging signal (ψ); promoters (CMV, CAG, RSV, U6 and EFS), polyadenylation signal (pA), posttranscriptional regulatory element (WPRE). ( B ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the first generation of the two-component lentivector (VECTR-Cas(sgGFP); red entry) or a control LentiCRISPRv2(sgGFP) (blue entry).
Cas9 Coding Sequence, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc07430633-34-30-13?v=Integrated+DNA+Technologies
Average 99 stars, based on 1 article reviews
cas9 coding sequence - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
Addgene inc cas9 cds
Delivery of the first generation of the two-component lentivector nanoparticles carrying the <t>Cas9</t> nuclease protein and a template for the U6-sgRNA expression cassette (VECTR-Cas(sgGFP)) to human HEK293-EGFP cells. ( A ) Design of the constructs to generate the lentivector particles. Cas9 was fused to the C-terminus of Vpr containing an authentic HIV-1 protease cleavage site (CTLNF/PISPI; Vpr.Prot.Cas9). The U6-sgRNA expression cassette was incorporated into a lentiviral expression vector (Lenti(sgRNA)). The packaging construct (psPAX2) encodes the structural and enzymatic components of virions. The VSV.G envelope protein was used to pseudotype and stabilize viral particles (pHCMV-G). Efficient nuclear export and colocalization of mRNA for translation were supported by adding the Rev-responsive element (RRE) to the constructs and by overexpressing Rev during virion production (pRSV-Rev). Gag-Pol subunits: matrix (MA), capsid (CA), nucleocapsid (NC), p6, protease (PR), reverse transcriptase (RT) and integrase (IN). Packaging signal (ψ); promoters (CMV, CAG, RSV, U6 and EFS), polyadenylation signal (pA), posttranscriptional regulatory element (WPRE). ( B ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the first generation of the two-component lentivector (VECTR-Cas(sgGFP); red entry) or a control LentiCRISPRv2(sgGFP) (blue entry).
Cas9 Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc11365971-46-44-62?v=Addgene+inc
Average 94 stars, based on 1 article reviews
cas9 cds - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Addgene inc coding sequence cds
Delivery of the first generation of the two-component lentivector nanoparticles carrying the <t>Cas9</t> nuclease protein and a template for the U6-sgRNA expression cassette (VECTR-Cas(sgGFP)) to human HEK293-EGFP cells. ( A ) Design of the constructs to generate the lentivector particles. Cas9 was fused to the C-terminus of Vpr containing an authentic HIV-1 protease cleavage site (CTLNF/PISPI; Vpr.Prot.Cas9). The U6-sgRNA expression cassette was incorporated into a lentiviral expression vector (Lenti(sgRNA)). The packaging construct (psPAX2) encodes the structural and enzymatic components of virions. The VSV.G envelope protein was used to pseudotype and stabilize viral particles (pHCMV-G). Efficient nuclear export and colocalization of mRNA for translation were supported by adding the Rev-responsive element (RRE) to the constructs and by overexpressing Rev during virion production (pRSV-Rev). Gag-Pol subunits: matrix (MA), capsid (CA), nucleocapsid (NC), p6, protease (PR), reverse transcriptase (RT) and integrase (IN). Packaging signal (ψ); promoters (CMV, CAG, RSV, U6 and EFS), polyadenylation signal (pA), posttranscriptional regulatory element (WPRE). ( B ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the first generation of the two-component lentivector (VECTR-Cas(sgGFP); red entry) or a control LentiCRISPRv2(sgGFP) (blue entry).
Coding Sequence Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc04376861-55-4-12?v=Addgene+inc
Average 93 stars, based on 1 article reviews
coding sequence cds - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
Addgene inc spcas9 coding sequences
The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels, compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Dunnett’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2x4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001.
Spcas9 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/bio_rxiv__2024__07__19__604224-127-6-17?v=Addgene+inc
Average 96 stars, based on 1 article reviews
spcas9 coding sequences - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Addgene inc zebrafish codon optimized cas9 coding sequence
The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels, compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Dunnett’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2x4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001.
Zebrafish Codon Optimized Cas9 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/hamar_jens_carlton__2024__the_myo_inositol_biosynthesis_pathway_and_its_regulation_by_nfat5_in_tilapia_salinity_tolerance-298-1-10?v=Addgene+inc
Average 93 stars, based on 1 article reviews
zebrafish codon optimized cas9 coding sequence - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc pbs hsp70 cas9
The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels, compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Dunnett’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2x4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001.
Pbs Hsp70 Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc08555087-626-21-22?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pbs hsp70 cas9 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

98
New England Biolabs coding sequence for cas9
A ) Strategy for the generation of the seiGFP allele by using CRISPR/ <t>Cas9</t> -dependent DNA editing. Stars represent single nucleotide substitutions in the PAMs of sgRNA sites. B-C) Behavior of seiGFP and wildtype flies in the acute heat assay. n=12. Data was analyzed using Student’s t -test and presented as mean ±SEM.
Coding Sequence For Cas9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/bio_rxiv__521005-126-28-40?v=New+England+Biolabs
Average 98 stars, based on 1 article reviews
coding sequence for cas9 - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

99
Integrated DNA Technologies hifi cas9 nuclease v3
Identification of HIV inhibitory factors by genome-wide SAM <t>CRISPR/Cas9</t> screening. ( A ) Schematic representation of the genome-wide SAM CRISPR/Cas9 screen of human MT4 cells. A stable MT4 cell line expressing dCas9-VP64 and MS2-p65-HSF1 was transduced with the sgRNA library, infected with HIV-TK, and then treated with ganciclovir (GCV) to further deplete HIV-infected cells. The HIV-TK infection and GCV selection cycle was repeated, and surviving HIV-resistant cells were sorted for analysis. sgRNA libraries were prepared from genomic DNA by nested PCR and sequenced. Differentially enriched sgRNAs were identified and the genes were further analyzed as candidate HIV-1 restriction factors. ( B ) Target hit validation. MT4 cells were transduced with control shRNA (shNC) or the indicated gene-specific shRNAs for 2 days followed by infection with HIV-TK (MOI 0.1) for 3 days. Cells were harvested to extract the RNA, and RT-PCR was performed to quantify the expression of HIV-1 env relative to GAPDH. Mean ± SD of n = 3. * P < 0.05, ** P < 0.01, **** P < 0.0001, by Student's t test. ( C , D ) SAM mediated activation of SET, KCTD1, KiAA1586, ORAI3, and ATP1B1 inhibit HIV-1 replication. dCas9 and MS2 MT4 cells were transduced with lentivirus expressing control sgRNA (sgNC) or sgRNA of indicated genes. After 2 days, cells were infected with HIV-1 LAI at an MOI of 0.1 for 3 days. Cellular RNA was extracted, and RT-qPCR was performed to quantify the expression of HIV-1 env relative to GAPDH (C). The release of HIV-1 particles in the supernatant was detected by p24 ELISA (D). Mean ± SD of n = 3. ** P < 0.01, *** P < 0.001, **** P < 0.0001, by Student's t test.
Hifi Cas9 Nuclease V3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc09262610-82-0-29?v=Integrated+DNA+Technologies
Average 99 stars, based on 1 article reviews
hifi cas9 nuclease v3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
Addgene inc fidelity cas9 nuclease construct
Functional impacts of a HSCR-associated SNP (rs2435357) and the deletion of a novel S-HSCR enhancer on RET expression. (A) ATAC-seq and ChIP-seq profiles of hPSC and hNC in intron 1 of RET show that rs2435357 is residing in a hNC-specific ATAC-seq peak. (B) Location of rs2435357 in the RET gene locus and in the sgRNA used for <t>CRISPR-Cas9-mediated</t> HDR for editing the C allele to the HSCR-associated risk allele T. The electrographs of Sanger sequencing show the successful introduction of the risk allele at rs2435357 in the UE-rs2435357 hPSC line. (C) Differentiation strategy to generate human neural crest (hNC) and neuronal progenitor (hNP). HU is encoded by the ELAVL4 gene. Immunostaining of SOX10 and TUJ1 in hNC and hNP of the control and the mutant (UE-rs2435357) lines. Scale bars: (hNC) 100 μm; (hNP) 200 μm. RT-qPCR analysis showing the comparable ELAVL4 expression level in hNP in the control (n = 5) and the mutant (UE-rs2435357) (n = 3) lines. t-test, (ns) not significant. (D) RT-qPCR analysis showing RET expression in the hPSC and hNP stages of the control (n = 5) and the mutant (UE-rs2435357) (n = 3). t-test, (ns) not significant. (E) Hi-C data from neural progenitor cells show that the enhancer in intron 1 of RASGEF1A (marked in yellow on the right) has physical interaction with the promoter of RET (marked in yellow on the left) at 10-kbp bin size. (F) ATAC-seq and ChIP-seq data from hPSC and hNC at the RASGEF1A intron 1 locus. (G) The design of sgRNAs used for the CRISPR-Cas9 system for deleting the DNA fragment in RASGEF1A intron 1. Genotyping reveals the specific deletion of RASGEF1A intron 1 in the UE-RASGEF1A-int1-KO hPSC line. (WT) Wild type, (KO) knockout. (H) Immunostaining of SOX10, TUJ1, and HU in hNC and hNP of the control and the mutant (RASGEF1A-int1-KO) lines, respectively. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (I) RT-qPCR reveals the expression level of RET in the hPSC and hNP stages of the control (n = 4–5) and the mutant (RASGEF1A-int1-KO) (n = 6–7). t-test, (ns) not significant.
Fidelity Cas9 Nuclease Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc07605255-441-5-18?v=Addgene+inc
Average 96 stars, based on 1 article reviews
fidelity cas9 nuclease construct - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology p53 crispr cas9 ko plasmid
Functional impacts of a HSCR-associated SNP (rs2435357) and the deletion of a novel S-HSCR enhancer on RET expression. (A) ATAC-seq and ChIP-seq profiles of hPSC and hNC in intron 1 of RET show that rs2435357 is residing in a hNC-specific ATAC-seq peak. (B) Location of rs2435357 in the RET gene locus and in the sgRNA used for <t>CRISPR-Cas9-mediated</t> HDR for editing the C allele to the HSCR-associated risk allele T. The electrographs of Sanger sequencing show the successful introduction of the risk allele at rs2435357 in the UE-rs2435357 hPSC line. (C) Differentiation strategy to generate human neural crest (hNC) and neuronal progenitor (hNP). HU is encoded by the ELAVL4 gene. Immunostaining of SOX10 and TUJ1 in hNC and hNP of the control and the mutant (UE-rs2435357) lines. Scale bars: (hNC) 100 μm; (hNP) 200 μm. RT-qPCR analysis showing the comparable ELAVL4 expression level in hNP in the control (n = 5) and the mutant (UE-rs2435357) (n = 3) lines. t-test, (ns) not significant. (D) RT-qPCR analysis showing RET expression in the hPSC and hNP stages of the control (n = 5) and the mutant (UE-rs2435357) (n = 3). t-test, (ns) not significant. (E) Hi-C data from neural progenitor cells show that the enhancer in intron 1 of RASGEF1A (marked in yellow on the right) has physical interaction with the promoter of RET (marked in yellow on the left) at 10-kbp bin size. (F) ATAC-seq and ChIP-seq data from hPSC and hNC at the RASGEF1A intron 1 locus. (G) The design of sgRNAs used for the CRISPR-Cas9 system for deleting the DNA fragment in RASGEF1A intron 1. Genotyping reveals the specific deletion of RASGEF1A intron 1 in the UE-RASGEF1A-int1-KO hPSC line. (WT) Wild type, (KO) knockout. (H) Immunostaining of SOX10, TUJ1, and HU in hNC and hNP of the control and the mutant (RASGEF1A-int1-KO) lines, respectively. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (I) RT-qPCR reveals the expression level of RET in the hPSC and hNP stages of the control (n = 4–5) and the mutant (RASGEF1A-int1-KO) (n = 6–7). t-test, (ns) not significant.
P53 Crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/pmc05510006-837-14-34?v=Santa+Cruz+Biotechnology
Average 95 stars, based on 1 article reviews
p53 crispr cas9 ko plasmid - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

94
Addgene inc sequence genemedi
Functional impacts of a HSCR-associated SNP (rs2435357) and the deletion of a novel S-HSCR enhancer on RET expression. (A) ATAC-seq and ChIP-seq profiles of hPSC and hNC in intron 1 of RET show that rs2435357 is residing in a hNC-specific ATAC-seq peak. (B) Location of rs2435357 in the RET gene locus and in the sgRNA used for <t>CRISPR-Cas9-mediated</t> HDR for editing the C allele to the HSCR-associated risk allele T. The electrographs of Sanger sequencing show the successful introduction of the risk allele at rs2435357 in the UE-rs2435357 hPSC line. (C) Differentiation strategy to generate human neural crest (hNC) and neuronal progenitor (hNP). HU is encoded by the ELAVL4 gene. Immunostaining of SOX10 and TUJ1 in hNC and hNP of the control and the mutant (UE-rs2435357) lines. Scale bars: (hNC) 100 μm; (hNP) 200 μm. RT-qPCR analysis showing the comparable ELAVL4 expression level in hNP in the control (n = 5) and the mutant (UE-rs2435357) (n = 3) lines. t-test, (ns) not significant. (D) RT-qPCR analysis showing RET expression in the hPSC and hNP stages of the control (n = 5) and the mutant (UE-rs2435357) (n = 3). t-test, (ns) not significant. (E) Hi-C data from neural progenitor cells show that the enhancer in intron 1 of RASGEF1A (marked in yellow on the right) has physical interaction with the promoter of RET (marked in yellow on the left) at 10-kbp bin size. (F) ATAC-seq and ChIP-seq data from hPSC and hNC at the RASGEF1A intron 1 locus. (G) The design of sgRNAs used for the CRISPR-Cas9 system for deleting the DNA fragment in RASGEF1A intron 1. Genotyping reveals the specific deletion of RASGEF1A intron 1 in the UE-RASGEF1A-int1-KO hPSC line. (WT) Wild type, (KO) knockout. (H) Immunostaining of SOX10, TUJ1, and HU in hNC and hNP of the control and the mutant (RASGEF1A-int1-KO) lines, respectively. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (I) RT-qPCR reveals the expression level of RET in the hPSC and hNP stages of the control (n = 4–5) and the mutant (RASGEF1A-int1-KO) (n = 6–7). t-test, (ns) not significant.
Sequence Genemedi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+cas9+coding+sequences/bio_rxiv__2020__03__26__010694-37-11-23?v=Addgene+inc
Average 94 stars, based on 1 article reviews
sequence genemedi - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic representation of the mouse and human Tyr loci and the CRISPR/Cas9 experimental design of the two RNA guides are represented in the exon 1 sequence. SDE-sgRNAs match the splice site between exon 1 and intron 1–2. IE-sgRNAs target a central position at the coding sequence of exon 1. (B) Schematic representation of the mouse and human ATM loci and the CRISPR/Cas9 experimental design the two RNA guides are represented in the exon 10 sequence. SDE-sgRNAs match the splice site between exon 10 and intron 10–11, and IE-sgRNAs target a coding sequence of exon 10. (C) Schematic representation of the human ABL-1 locus and the CRISPR/Cas9 experimental design the two RNA guides. SDE-sgRNAs match the splice site between exon 4 and intron 4–5, and IE-sgRNAs target a coding sequence of exon 6. Sequences of each SDE-sgRNA are represented (blue line) and its expected cleavage point (blue arrowhead) at the splice donor sequence (red dotted box). Also, several candidates to SDE-sgRNAs are listed with its respective scores (red box correspond to selected sgRNAs).

Journal: PLoS ONE

Article Title: Splice donor site sgRNAs enhance CRISPR/Cas9-mediated knockout efficiency

doi: 10.1371/journal.pone.0216674

Figure Lengend Snippet: (A) Schematic representation of the mouse and human Tyr loci and the CRISPR/Cas9 experimental design of the two RNA guides are represented in the exon 1 sequence. SDE-sgRNAs match the splice site between exon 1 and intron 1–2. IE-sgRNAs target a central position at the coding sequence of exon 1. (B) Schematic representation of the mouse and human ATM loci and the CRISPR/Cas9 experimental design the two RNA guides are represented in the exon 10 sequence. SDE-sgRNAs match the splice site between exon 10 and intron 10–11, and IE-sgRNAs target a coding sequence of exon 10. (C) Schematic representation of the human ABL-1 locus and the CRISPR/Cas9 experimental design the two RNA guides. SDE-sgRNAs match the splice site between exon 4 and intron 4–5, and IE-sgRNAs target a coding sequence of exon 6. Sequences of each SDE-sgRNA are represented (blue line) and its expected cleavage point (blue arrowhead) at the splice donor sequence (red dotted box). Also, several candidates to SDE-sgRNAs are listed with its respective scores (red box correspond to selected sgRNAs).

Article Snippet: pX458 (Addgene plasmid # 48138)[ ], which contains the coding sequence of Cas9 nuclease and GFP, and a cloning site for sgRNA sequence, was digested with BpiI (NEB).

Techniques: CRISPR, Sequencing

(A) Fluorescent microscopy of cells electroporated with empty px480 vector (controls) and carrying each RNA guides. (B) Sequences of CRISPR/Cas9 edited cells through IE-sgRNA (red box) and SDE-sgRNA (blue box). Edited cells showed a mixture of sequences around the expected cleavage point for each sgRNA.

Journal: PLoS ONE

Article Title: Splice donor site sgRNAs enhance CRISPR/Cas9-mediated knockout efficiency

doi: 10.1371/journal.pone.0216674

Figure Lengend Snippet: (A) Fluorescent microscopy of cells electroporated with empty px480 vector (controls) and carrying each RNA guides. (B) Sequences of CRISPR/Cas9 edited cells through IE-sgRNA (red box) and SDE-sgRNA (blue box). Edited cells showed a mixture of sequences around the expected cleavage point for each sgRNA.

Article Snippet: pX458 (Addgene plasmid # 48138)[ ], which contains the coding sequence of Cas9 nuclease and GFP, and a cloning site for sgRNA sequence, was digested with BpiI (NEB).

Techniques: Microscopy, Plasmid Preparation, CRISPR

Graphic NGS analysis of CRISPR/Cas9-mediated edition of Tyr locus in mouse blastocysts. Genotyping of embryos microinjected with sgRNAs targeting Tyr gene, by NGS, revealed that only 67.57% of edited sequences from embryos microinjected with IE-m Tyr sgRNA correspond to null alleles, while 100% SDE-m Tyr sgRNA-modified alleles gave rise to null alleles. Black and gray circles correspond to null and functional alleles, respectively, while the background indicates the type of mutation (dark blue: splice donor site in-frame and/or frameshift; light blue: frameshift).

Journal: PLoS ONE

Article Title: Splice donor site sgRNAs enhance CRISPR/Cas9-mediated knockout efficiency

doi: 10.1371/journal.pone.0216674

Figure Lengend Snippet: Graphic NGS analysis of CRISPR/Cas9-mediated edition of Tyr locus in mouse blastocysts. Genotyping of embryos microinjected with sgRNAs targeting Tyr gene, by NGS, revealed that only 67.57% of edited sequences from embryos microinjected with IE-m Tyr sgRNA correspond to null alleles, while 100% SDE-m Tyr sgRNA-modified alleles gave rise to null alleles. Black and gray circles correspond to null and functional alleles, respectively, while the background indicates the type of mutation (dark blue: splice donor site in-frame and/or frameshift; light blue: frameshift).

Article Snippet: pX458 (Addgene plasmid # 48138)[ ], which contains the coding sequence of Cas9 nuclease and GFP, and a cloning site for sgRNA sequence, was digested with BpiI (NEB).

Techniques: CRISPR, Modification, Functional Assay, Mutagenesis

Delivery of the first generation of the two-component lentivector nanoparticles carrying the Cas9 nuclease protein and a template for the U6-sgRNA expression cassette (VECTR-Cas(sgGFP)) to human HEK293-EGFP cells. ( A ) Design of the constructs to generate the lentivector particles. Cas9 was fused to the C-terminus of Vpr containing an authentic HIV-1 protease cleavage site (CTLNF/PISPI; Vpr.Prot.Cas9). The U6-sgRNA expression cassette was incorporated into a lentiviral expression vector (Lenti(sgRNA)). The packaging construct (psPAX2) encodes the structural and enzymatic components of virions. The VSV.G envelope protein was used to pseudotype and stabilize viral particles (pHCMV-G). Efficient nuclear export and colocalization of mRNA for translation were supported by adding the Rev-responsive element (RRE) to the constructs and by overexpressing Rev during virion production (pRSV-Rev). Gag-Pol subunits: matrix (MA), capsid (CA), nucleocapsid (NC), p6, protease (PR), reverse transcriptase (RT) and integrase (IN). Packaging signal (ψ); promoters (CMV, CAG, RSV, U6 and EFS), polyadenylation signal (pA), posttranscriptional regulatory element (WPRE). ( B ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the first generation of the two-component lentivector (VECTR-Cas(sgGFP); red entry) or a control LentiCRISPRv2(sgGFP) (blue entry).

Journal: Nucleic Acids Research

Article Title: Highly efficient ‘hit-and-run’ genome editing with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts

doi: 10.1093/nar/gkaa561

Figure Lengend Snippet: Delivery of the first generation of the two-component lentivector nanoparticles carrying the Cas9 nuclease protein and a template for the U6-sgRNA expression cassette (VECTR-Cas(sgGFP)) to human HEK293-EGFP cells. ( A ) Design of the constructs to generate the lentivector particles. Cas9 was fused to the C-terminus of Vpr containing an authentic HIV-1 protease cleavage site (CTLNF/PISPI; Vpr.Prot.Cas9). The U6-sgRNA expression cassette was incorporated into a lentiviral expression vector (Lenti(sgRNA)). The packaging construct (psPAX2) encodes the structural and enzymatic components of virions. The VSV.G envelope protein was used to pseudotype and stabilize viral particles (pHCMV-G). Efficient nuclear export and colocalization of mRNA for translation were supported by adding the Rev-responsive element (RRE) to the constructs and by overexpressing Rev during virion production (pRSV-Rev). Gag-Pol subunits: matrix (MA), capsid (CA), nucleocapsid (NC), p6, protease (PR), reverse transcriptase (RT) and integrase (IN). Packaging signal (ψ); promoters (CMV, CAG, RSV, U6 and EFS), polyadenylation signal (pA), posttranscriptional regulatory element (WPRE). ( B ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the first generation of the two-component lentivector (VECTR-Cas(sgGFP); red entry) or a control LentiCRISPRv2(sgGFP) (blue entry).

Article Snippet: A pVpr.Prot.Cas9 plasmid was constructed by Gibson assembly of a gBlock ordered from IDT (containing Vpr-, protease cleavage site-, and SV40 nuclear localization signal–coding sequence) and two PCR products containing Cas9 coding sequence and Rev-responsive element (RRE), respectively.

Techniques: Expressing, Construct, Plasmid Preparation, Transduction

Enhanced packaging of the Vpr.Prot.Cas9 fusion protein produced from the transcript containing the Rev responsive element (RRE). ( A ) Schematic representation of the expression cassettes encoding Vpr.Prot.Cas9 fusion protein. The transcripts encoding Cas9 contain either the Rev responsive element (RRE) or the constitutive transport element (CTE). ( B ) The constructs were co-transfected into HEK293T cells together with psPAX2 (encodes structural and enzymatic components of virions from transcript containing the RRE) and with the other plasmids required for virus production as described in the Figure . The presence of viral and heterologous proteins in the cell lysates (cell) and virions (virus) harvested from cell culture supernatant 48 h after transfection was determined by immunoblotting with antibodies as follows. The blot was probed with an antibody specific for the Cas9 protein. Next, the membrane was washed and re-probed with an antibody detecting the p24 (CA) and Pr55 (Gag) proteins to monitor the expression of the viral structural proteins in the lysates and to determine the amounts of virions released from transfected cells. Equivalent loading was confirmed by re-probing with an antibody directed against the HSP90 protein and by Coomassie blue staining of the SDS-PAGE gel after blotting. One representative example from three biological replicates performed in three different weeks is shown; 293T, untransfected cells; M, Color Prestained Standard NEB #P7712. ( C ) A model describing how nuclear export functions affect the packaging of heterologous proteins into virions. Retrovirus assembly and budding is a highly concerted process. It is mediated by numerous, largely undefined spatially and temporally regulated interactions between viral proteins and cellular factors. Previous reports showed that the regulation of the HIV-1 Gag assembly begins as soon as nuclear export factors are deposited onto the transcripts encoding the structural components of HIV-1. Here, we present a model whereby the selection of RNA export pathway modulates the cytosolic fate and function of the transcripts encoding heterologous proteins and facilitates the packaging of non-viral proteins into virions. The nuclear export of both viral and non-viral transcripts via the same pathway facilitates the cytoplasmic co-localization of the transcripts and their translation products. The close proximity of Gag and Vpr.Prot.Cas9 promotes the interaction between the two polyproteins that is required for encapsidation of the fusion protein into virions.

Journal: Nucleic Acids Research

Article Title: Highly efficient ‘hit-and-run’ genome editing with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts

doi: 10.1093/nar/gkaa561

Figure Lengend Snippet: Enhanced packaging of the Vpr.Prot.Cas9 fusion protein produced from the transcript containing the Rev responsive element (RRE). ( A ) Schematic representation of the expression cassettes encoding Vpr.Prot.Cas9 fusion protein. The transcripts encoding Cas9 contain either the Rev responsive element (RRE) or the constitutive transport element (CTE). ( B ) The constructs were co-transfected into HEK293T cells together with psPAX2 (encodes structural and enzymatic components of virions from transcript containing the RRE) and with the other plasmids required for virus production as described in the Figure . The presence of viral and heterologous proteins in the cell lysates (cell) and virions (virus) harvested from cell culture supernatant 48 h after transfection was determined by immunoblotting with antibodies as follows. The blot was probed with an antibody specific for the Cas9 protein. Next, the membrane was washed and re-probed with an antibody detecting the p24 (CA) and Pr55 (Gag) proteins to monitor the expression of the viral structural proteins in the lysates and to determine the amounts of virions released from transfected cells. Equivalent loading was confirmed by re-probing with an antibody directed against the HSP90 protein and by Coomassie blue staining of the SDS-PAGE gel after blotting. One representative example from three biological replicates performed in three different weeks is shown; 293T, untransfected cells; M, Color Prestained Standard NEB #P7712. ( C ) A model describing how nuclear export functions affect the packaging of heterologous proteins into virions. Retrovirus assembly and budding is a highly concerted process. It is mediated by numerous, largely undefined spatially and temporally regulated interactions between viral proteins and cellular factors. Previous reports showed that the regulation of the HIV-1 Gag assembly begins as soon as nuclear export factors are deposited onto the transcripts encoding the structural components of HIV-1. Here, we present a model whereby the selection of RNA export pathway modulates the cytosolic fate and function of the transcripts encoding heterologous proteins and facilitates the packaging of non-viral proteins into virions. The nuclear export of both viral and non-viral transcripts via the same pathway facilitates the cytoplasmic co-localization of the transcripts and their translation products. The close proximity of Gag and Vpr.Prot.Cas9 promotes the interaction between the two polyproteins that is required for encapsidation of the fusion protein into virions.

Article Snippet: A pVpr.Prot.Cas9 plasmid was constructed by Gibson assembly of a gBlock ordered from IDT (containing Vpr-, protease cleavage site-, and SV40 nuclear localization signal–coding sequence) and two PCR products containing Cas9 coding sequence and Rev-responsive element (RRE), respectively.

Techniques: Produced, Expressing, Construct, Transfection, Cell Culture, Western Blot, Staining, SDS Page, Selection

Delivery of the second (VECTRv2-Cas(sgGFP)) or third (VECTRv3-Cas(sgGFP)) generation of the two-component lentivector nanoparticles to human HEK293-EGFP cells. ( A ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the second generation of the two-component lentivector (VECTRv2-Cas(sgGFP); red entries) or a control LentiCRISPRv2(sgGFP) (blue entry). ( B ) T7 endonuclease I (T7EI) assay to measure the indels in the EGFP gene resulting from transduction with the VECTRv2-Cas(sgGFP), the same vector lacking Vpr.Prot.Cas9 or a control vector pLentiCRISPRv2(sgGFP). The frequency of indel formation was calculated as described in the methods section. Please note that it may decrease the actual editing efficiency for highly efficient editing. ( C ) Mutant sequences at the EGFP locus and their frequencies, as determined by SYNTHEGO analysis of Sanger sequencing of a PCR product amplified from VECTRv2-Cas(sgGFP)-transduced HEK293-EGFP cells. The 20-nt target sequence is shown with a blue background. The protospacer adjacent motif (PAM) sequence is shown in blue. ( D ) Comparison of EGFP disruption after transduction with lentiviral particles containing integration-deficient (D64V; VECTRv3-Cas(sgGFP)) or integration-proficient (WT; VECTRv2-Cas(sgGFP)) integrase. ( E ) Time-course analysis of EGFP disruption mediated by the VECTRv3-Cas(sgGFP) or the gene-delivering LentiCRISPRv2(sgGFP). ( F ) A schematic representation of lentivector-mediated delivery of the Cas9 protein and viral RNA containing U6-sgRNA. Cas9 is packaged into virions as a Vpr.Prot.Cas9 fusion polyprotein that is proteolytically cleaved during virion maturation . Following virus entry into a recipient cell , the viral genome is reverse transcribed to DNA and translocated to the nucleus together with Cas9 , where the U6 promoter drives the expression of sgRNA . The nascent sgRNA associates with Cas9 and directs the nuclease to the target site in the genomic DNA (gDNA) for cleavage . (A, D) The mean activities of three replicates are shown. (E) The mean of two replicates are shown. (A, D, E) Error bars, mean ± s.e.m.

Journal: Nucleic Acids Research

Article Title: Highly efficient ‘hit-and-run’ genome editing with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts

doi: 10.1093/nar/gkaa561

Figure Lengend Snippet: Delivery of the second (VECTRv2-Cas(sgGFP)) or third (VECTRv3-Cas(sgGFP)) generation of the two-component lentivector nanoparticles to human HEK293-EGFP cells. ( A ) The EGFP gene disruption in HEK293-EGFP cells after transduction with the second generation of the two-component lentivector (VECTRv2-Cas(sgGFP); red entries) or a control LentiCRISPRv2(sgGFP) (blue entry). ( B ) T7 endonuclease I (T7EI) assay to measure the indels in the EGFP gene resulting from transduction with the VECTRv2-Cas(sgGFP), the same vector lacking Vpr.Prot.Cas9 or a control vector pLentiCRISPRv2(sgGFP). The frequency of indel formation was calculated as described in the methods section. Please note that it may decrease the actual editing efficiency for highly efficient editing. ( C ) Mutant sequences at the EGFP locus and their frequencies, as determined by SYNTHEGO analysis of Sanger sequencing of a PCR product amplified from VECTRv2-Cas(sgGFP)-transduced HEK293-EGFP cells. The 20-nt target sequence is shown with a blue background. The protospacer adjacent motif (PAM) sequence is shown in blue. ( D ) Comparison of EGFP disruption after transduction with lentiviral particles containing integration-deficient (D64V; VECTRv3-Cas(sgGFP)) or integration-proficient (WT; VECTRv2-Cas(sgGFP)) integrase. ( E ) Time-course analysis of EGFP disruption mediated by the VECTRv3-Cas(sgGFP) or the gene-delivering LentiCRISPRv2(sgGFP). ( F ) A schematic representation of lentivector-mediated delivery of the Cas9 protein and viral RNA containing U6-sgRNA. Cas9 is packaged into virions as a Vpr.Prot.Cas9 fusion polyprotein that is proteolytically cleaved during virion maturation . Following virus entry into a recipient cell , the viral genome is reverse transcribed to DNA and translocated to the nucleus together with Cas9 , where the U6 promoter drives the expression of sgRNA . The nascent sgRNA associates with Cas9 and directs the nuclease to the target site in the genomic DNA (gDNA) for cleavage . (A, D) The mean activities of three replicates are shown. (E) The mean of two replicates are shown. (A, D, E) Error bars, mean ± s.e.m.

Article Snippet: A pVpr.Prot.Cas9 plasmid was constructed by Gibson assembly of a gBlock ordered from IDT (containing Vpr-, protease cleavage site-, and SV40 nuclear localization signal–coding sequence) and two PCR products containing Cas9 coding sequence and Rev-responsive element (RRE), respectively.

Techniques: Transduction, T7EI Assay, Plasmid Preparation, Mutagenesis, Sequencing, Amplification, Expressing

The modified 3TC scaffold boosts SpCas9 gRNA expression levels, compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Dunnett’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2x4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001.

Journal: bioRxiv

Article Title: Enhancing gRNA Transcript levels by Reducing the Scaffold Poly-T Tract for Optimal SpCas9- and SaCas9-mediated Gene Editing

doi: 10.1101/2024.07.19.604224

Figure Lengend Snippet: The modified 3TC scaffold boosts SpCas9 gRNA expression levels, compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Dunnett’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2x4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log 2 RQ ± 95% CI; n=3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001.

Article Snippet: SaCas9-Puro.V2 was generated by replacing the SpCas9 coding sequences of PX459.V2 with SaCas9 coding sequences from PX601 (Addgene #61591).

Techniques: Modification, Expressing, Sequencing, Quantitative Proteomics, Quantitative RT-PCR, Comparison

Editing efficiencies of high-fidelity SpCas9s with the 3TC scaffold. Comparison of PX459.V2 SpCas9-HF1 (4T), PX459.V3 SpCas9-HF1 (3TC), PX459.V2 eSpCas9(1.1) (4T) and PX459.V3 eSpCas9(1.1) (3TC) plasmids delivered by lipofection at a (A) high and (B) low plasmid dose without puromycin selection in HEK239T cells, assessed by deep amplicon sequencing. Mean ± SEM; n=3. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (C) Editing efficiencies of hDMD-B in the G19 gRNA configuration with WT and high-fidelity Sp-Cas9 plasmids delivered by nucleofection with puromycin selection in HEK293Ts. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, ***p ≤ 0.001.

Journal: bioRxiv

Article Title: Enhancing gRNA Transcript levels by Reducing the Scaffold Poly-T Tract for Optimal SpCas9- and SaCas9-mediated Gene Editing

doi: 10.1101/2024.07.19.604224

Figure Lengend Snippet: Editing efficiencies of high-fidelity SpCas9s with the 3TC scaffold. Comparison of PX459.V2 SpCas9-HF1 (4T), PX459.V3 SpCas9-HF1 (3TC), PX459.V2 eSpCas9(1.1) (4T) and PX459.V3 eSpCas9(1.1) (3TC) plasmids delivered by lipofection at a (A) high and (B) low plasmid dose without puromycin selection in HEK239T cells, assessed by deep amplicon sequencing. Mean ± SEM; n=3. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (C) Editing efficiencies of hDMD-B in the G19 gRNA configuration with WT and high-fidelity Sp-Cas9 plasmids delivered by nucleofection with puromycin selection in HEK293Ts. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, ***p ≤ 0.001.

Article Snippet: SaCas9-Puro.V2 was generated by replacing the SpCas9 coding sequences of PX459.V2 with SaCas9 coding sequences from PX601 (Addgene #61591).

Techniques: Comparison, Plasmid Preparation, Selection, Amplification, Sequencing

A ) Strategy for the generation of the seiGFP allele by using CRISPR/ Cas9 -dependent DNA editing. Stars represent single nucleotide substitutions in the PAMs of sgRNA sites. B-C) Behavior of seiGFP and wildtype flies in the acute heat assay. n=12. Data was analyzed using Student’s t -test and presented as mean ±SEM.

Journal: bioRxiv

Article Title: The Drosophila ERG channel seizure plays a role in the neuronal homeostatic stress response

doi: 10.1101/521005

Figure Lengend Snippet: A ) Strategy for the generation of the seiGFP allele by using CRISPR/ Cas9 -dependent DNA editing. Stars represent single nucleotide substitutions in the PAMs of sgRNA sites. B-C) Behavior of seiGFP and wildtype flies in the acute heat assay. n=12. Data was analyzed using Student’s t -test and presented as mean ±SEM.

Article Snippet: Complementary oligos that correspond to each individual sgRNA (IDT) were cloned into the pDCC6 plasmid (a gift from Peter Duchek, Addgene plasmid # 59985), which also includes the coding sequence for Cas9 [ ], by using the BbsI restriction enzyme (NEB).

Techniques: CRISPR

Identification of HIV inhibitory factors by genome-wide SAM CRISPR/Cas9 screening. ( A ) Schematic representation of the genome-wide SAM CRISPR/Cas9 screen of human MT4 cells. A stable MT4 cell line expressing dCas9-VP64 and MS2-p65-HSF1 was transduced with the sgRNA library, infected with HIV-TK, and then treated with ganciclovir (GCV) to further deplete HIV-infected cells. The HIV-TK infection and GCV selection cycle was repeated, and surviving HIV-resistant cells were sorted for analysis. sgRNA libraries were prepared from genomic DNA by nested PCR and sequenced. Differentially enriched sgRNAs were identified and the genes were further analyzed as candidate HIV-1 restriction factors. ( B ) Target hit validation. MT4 cells were transduced with control shRNA (shNC) or the indicated gene-specific shRNAs for 2 days followed by infection with HIV-TK (MOI 0.1) for 3 days. Cells were harvested to extract the RNA, and RT-PCR was performed to quantify the expression of HIV-1 env relative to GAPDH. Mean ± SD of n = 3. * P < 0.05, ** P < 0.01, **** P < 0.0001, by Student's t test. ( C , D ) SAM mediated activation of SET, KCTD1, KiAA1586, ORAI3, and ATP1B1 inhibit HIV-1 replication. dCas9 and MS2 MT4 cells were transduced with lentivirus expressing control sgRNA (sgNC) or sgRNA of indicated genes. After 2 days, cells were infected with HIV-1 LAI at an MOI of 0.1 for 3 days. Cellular RNA was extracted, and RT-qPCR was performed to quantify the expression of HIV-1 env relative to GAPDH (C). The release of HIV-1 particles in the supernatant was detected by p24 ELISA (D). Mean ± SD of n = 3. ** P < 0.01, *** P < 0.001, **** P < 0.0001, by Student's t test.

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: Identification of HIV inhibitory factors by genome-wide SAM CRISPR/Cas9 screening. ( A ) Schematic representation of the genome-wide SAM CRISPR/Cas9 screen of human MT4 cells. A stable MT4 cell line expressing dCas9-VP64 and MS2-p65-HSF1 was transduced with the sgRNA library, infected with HIV-TK, and then treated with ganciclovir (GCV) to further deplete HIV-infected cells. The HIV-TK infection and GCV selection cycle was repeated, and surviving HIV-resistant cells were sorted for analysis. sgRNA libraries were prepared from genomic DNA by nested PCR and sequenced. Differentially enriched sgRNAs were identified and the genes were further analyzed as candidate HIV-1 restriction factors. ( B ) Target hit validation. MT4 cells were transduced with control shRNA (shNC) or the indicated gene-specific shRNAs for 2 days followed by infection with HIV-TK (MOI 0.1) for 3 days. Cells were harvested to extract the RNA, and RT-PCR was performed to quantify the expression of HIV-1 env relative to GAPDH. Mean ± SD of n = 3. * P < 0.05, ** P < 0.01, **** P < 0.0001, by Student's t test. ( C , D ) SAM mediated activation of SET, KCTD1, KiAA1586, ORAI3, and ATP1B1 inhibit HIV-1 replication. dCas9 and MS2 MT4 cells were transduced with lentivirus expressing control sgRNA (sgNC) or sgRNA of indicated genes. After 2 days, cells were infected with HIV-1 LAI at an MOI of 0.1 for 3 days. Cellular RNA was extracted, and RT-qPCR was performed to quantify the expression of HIV-1 env relative to GAPDH (C). The release of HIV-1 particles in the supernatant was detected by p24 ELISA (D). Mean ± SD of n = 3. ** P < 0.01, *** P < 0.001, **** P < 0.0001, by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Genome Wide, CRISPR, Expressing, Transduction, Infection, Selection, Nested PCR, shRNA, Reverse Transcription Polymerase Chain Reaction, Activation Assay, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

SET restricts HIV-1 replication in human CD4+ T cell lines and human PBMCs. (A–E) Knockout of SET enhances HIV-1 replication in CD4+ T cells. ( A ) Illustration of the three sgRNAs used for CRISPR/Cas9-mediated SET KO. ( B ) SET protein expression was analyzed in control sgRNA (sgNC) or SET sgRNA (sgSET #1, or #2 + 3) transduced MT4 cells by Western blotting. ( C ) Characterization of single Jurkat T cell clone knocked out for SET expression. Jurkat cells were transduced with sgSET#1 and SET expression was determined by Western blotting. ( D ) Control or SET depleted cells from panel B were infected with HIV-1 LAI at an MOI of 0.01 for 4 days. Time dependent p24 released in the supernatant was detected by p24 ELISA. ( E ) Control or SET knockout cells from panel C were infected with HIV pseudovirus (HIVpp-luc, MOI = 0.2) for 3 days. RNA was collected at the indicated times and HIV-1 env expression was quantified by RT-qPCR and normalized to GAPDH. (F–H) Ectopic expression of SET isoform 2 decreases HIV-1 replication. ( F ) Schematic representation of the 4 isoforms of SET. ( G ) SET isoform 2 was overexpressed in MT4 cells and SET expression was determined by Western blotting. ( H ) The cells were infected with HIVpp-luc at an MOI of 0.2. After 2 days, luciferase levels were measured. ( I–K ) KD of SET enhances HIV-1 replication in primary PBMCs from three different donors. Primary PBMCs were isolated from three healthy donors. T cells were activated using CD3 and CD28 antibodies. PBMCs were transduced with lentivirus vectors expressing non-targeting shRNA (shNC) or three SET specific shRNAs (shRNA1-3), followed by infection with HIV-1 LAI at an MOI of 0.02 or 0.1 for 3 days. p24 released in the supernatant was detected by p24 ELISA. ( L ) Control or SET depleted cells from panel C were infected with an X4-tropic stain Wilmington and a dual-tropic strain RF at an MOI of 0.01 for 3 days. RNA was collected and HIV env mRNA was quantified by RT-qPCR and normalized to GAPDH expression. ( M, N ) KD of SET enhances HIV-1 replication in microglia cells. Lentivirus expressing control shRNA or two SET specific shRNA were transduced into microglia cells (CHME) followed by puromycin selection for 7 days. Stable cell lines were infected with an R5-tropic stain Bal and a dual-tropic strain RF at an MOI of 0.2 for 3 days. env mRNA (M) and SET mRNA (N) was detected by RT-qPCR and normalized to GAPDH expression. Data in (B), (C) and (G) are representative of at least two independent experiments. GAPDH was used as a loading control. Mean ± SD of n = 3. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by Student's t test.

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: SET restricts HIV-1 replication in human CD4+ T cell lines and human PBMCs. (A–E) Knockout of SET enhances HIV-1 replication in CD4+ T cells. ( A ) Illustration of the three sgRNAs used for CRISPR/Cas9-mediated SET KO. ( B ) SET protein expression was analyzed in control sgRNA (sgNC) or SET sgRNA (sgSET #1, or #2 + 3) transduced MT4 cells by Western blotting. ( C ) Characterization of single Jurkat T cell clone knocked out for SET expression. Jurkat cells were transduced with sgSET#1 and SET expression was determined by Western blotting. ( D ) Control or SET depleted cells from panel B were infected with HIV-1 LAI at an MOI of 0.01 for 4 days. Time dependent p24 released in the supernatant was detected by p24 ELISA. ( E ) Control or SET knockout cells from panel C were infected with HIV pseudovirus (HIVpp-luc, MOI = 0.2) for 3 days. RNA was collected at the indicated times and HIV-1 env expression was quantified by RT-qPCR and normalized to GAPDH. (F–H) Ectopic expression of SET isoform 2 decreases HIV-1 replication. ( F ) Schematic representation of the 4 isoforms of SET. ( G ) SET isoform 2 was overexpressed in MT4 cells and SET expression was determined by Western blotting. ( H ) The cells were infected with HIVpp-luc at an MOI of 0.2. After 2 days, luciferase levels were measured. ( I–K ) KD of SET enhances HIV-1 replication in primary PBMCs from three different donors. Primary PBMCs were isolated from three healthy donors. T cells were activated using CD3 and CD28 antibodies. PBMCs were transduced with lentivirus vectors expressing non-targeting shRNA (shNC) or three SET specific shRNAs (shRNA1-3), followed by infection with HIV-1 LAI at an MOI of 0.02 or 0.1 for 3 days. p24 released in the supernatant was detected by p24 ELISA. ( L ) Control or SET depleted cells from panel C were infected with an X4-tropic stain Wilmington and a dual-tropic strain RF at an MOI of 0.01 for 3 days. RNA was collected and HIV env mRNA was quantified by RT-qPCR and normalized to GAPDH expression. ( M, N ) KD of SET enhances HIV-1 replication in microglia cells. Lentivirus expressing control shRNA or two SET specific shRNA were transduced into microglia cells (CHME) followed by puromycin selection for 7 days. Stable cell lines were infected with an R5-tropic stain Bal and a dual-tropic strain RF at an MOI of 0.2 for 3 days. env mRNA (M) and SET mRNA (N) was detected by RT-qPCR and normalized to GAPDH expression. Data in (B), (C) and (G) are representative of at least two independent experiments. GAPDH was used as a loading control. Mean ± SD of n = 3. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Knock-Out, CRISPR, Expressing, Western Blot, Transduction, Infection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Luciferase, Isolation, shRNA, Staining, Selection, Stable Transfection

SET represses HIV-1 integration but does not alter integration sites. (A–C) SET knockout in PBMCs enhances the integration of HIV-1. ( A ) Illustration of in vitro ribonucleoprotein complexes (Cas9-RNPs) formation and delivery into PBMCs. PBMCs isolated from the blood of healthy donors were activated by using CD3 and CD28 antibodies. Then, cells were electroporated with Cas9-RNPs, which consisted of the Cas9 nuclease bound to a SET CRISPR RNA (crRNA-SET) and the trans-activating crRNA (tracRNA). ( B , C ) PBMC of two healthy donors were delivered with the SET Cas9-RNPs. After 6 days in culture to allow for depletion of the targeted gene, the cells were infected with HIVpp-luc (MOI = 2) for 3 days to enable efficient integration of the single cycle reporter virus. Integrated HIV-1 DNA was quantified by Alu qPCR, and SET expression detected using Western blot. Integrated HIV-1 DNA was normalized to genomic GAPDH. Mean ± SD of n = 3. * P < 0.05, *** P < 0.001 by Student's t test. Western blot data are representative of at least two independent experiments. Tubulin was used as a loading control. ( D–G ) SET depletion does not appreciably alter sites of HIV-1 integration. HIV-1 integration site sequencing was performed in HIVpp-luc infected (MOI = 0.2) MT4 cells depleted for SET by the MLV KD system. Meanwhile, two SET depleted sets of PBMCs prepared in panels (B), (C) were subjected to integration site sequencing. Cellular DNA from infected control or SET depleted cells were extracted. Sites of HIV-1 integration, which were amplified by ligation-mediated PCR, were sequenced using Illumina. Integration site analysis of HIV-1 DNA integration sites mapped with respect to RefSeq genes (D), surrounding gene density (E), SPADs (F) and LADs (G). RIC, random integration control. ( H, I ) SET inhibits H3ac-associated HIV-1 DNA. Acetylated H3 ChIP (H3ac-ChIP, H) and total H3 ChIP (I) assays of Jurkat cells expressing sgNC (control) or sgSET (SET KO) and infected with HIV-1 LAI (MOI = 1) for 2 days. Immunoprecipitates were subjected to qPCR with primers specific for four regions of HIV-1 DNA: Nucleosome (Nuc)-0, Nuc-1, Nuc-2 and DHS (DNase I highly sensitive). Mean ± SD of n = 2. * P < 0.05, ** P < 0.01 by Student's t test.

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: SET represses HIV-1 integration but does not alter integration sites. (A–C) SET knockout in PBMCs enhances the integration of HIV-1. ( A ) Illustration of in vitro ribonucleoprotein complexes (Cas9-RNPs) formation and delivery into PBMCs. PBMCs isolated from the blood of healthy donors were activated by using CD3 and CD28 antibodies. Then, cells were electroporated with Cas9-RNPs, which consisted of the Cas9 nuclease bound to a SET CRISPR RNA (crRNA-SET) and the trans-activating crRNA (tracRNA). ( B , C ) PBMC of two healthy donors were delivered with the SET Cas9-RNPs. After 6 days in culture to allow for depletion of the targeted gene, the cells were infected with HIVpp-luc (MOI = 2) for 3 days to enable efficient integration of the single cycle reporter virus. Integrated HIV-1 DNA was quantified by Alu qPCR, and SET expression detected using Western blot. Integrated HIV-1 DNA was normalized to genomic GAPDH. Mean ± SD of n = 3. * P < 0.05, *** P < 0.001 by Student's t test. Western blot data are representative of at least two independent experiments. Tubulin was used as a loading control. ( D–G ) SET depletion does not appreciably alter sites of HIV-1 integration. HIV-1 integration site sequencing was performed in HIVpp-luc infected (MOI = 0.2) MT4 cells depleted for SET by the MLV KD system. Meanwhile, two SET depleted sets of PBMCs prepared in panels (B), (C) were subjected to integration site sequencing. Cellular DNA from infected control or SET depleted cells were extracted. Sites of HIV-1 integration, which were amplified by ligation-mediated PCR, were sequenced using Illumina. Integration site analysis of HIV-1 DNA integration sites mapped with respect to RefSeq genes (D), surrounding gene density (E), SPADs (F) and LADs (G). RIC, random integration control. ( H, I ) SET inhibits H3ac-associated HIV-1 DNA. Acetylated H3 ChIP (H3ac-ChIP, H) and total H3 ChIP (I) assays of Jurkat cells expressing sgNC (control) or sgSET (SET KO) and infected with HIV-1 LAI (MOI = 1) for 2 days. Immunoprecipitates were subjected to qPCR with primers specific for four regions of HIV-1 DNA: Nucleosome (Nuc)-0, Nuc-1, Nuc-2 and DHS (DNase I highly sensitive). Mean ± SD of n = 2. * P < 0.05, ** P < 0.01 by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Knock-Out, In Vitro, Isolation, CRISPR, Infection, Expressing, Western Blot, Sequencing, Amplification, Ligation

Functional impacts of a HSCR-associated SNP (rs2435357) and the deletion of a novel S-HSCR enhancer on RET expression. (A) ATAC-seq and ChIP-seq profiles of hPSC and hNC in intron 1 of RET show that rs2435357 is residing in a hNC-specific ATAC-seq peak. (B) Location of rs2435357 in the RET gene locus and in the sgRNA used for CRISPR-Cas9-mediated HDR for editing the C allele to the HSCR-associated risk allele T. The electrographs of Sanger sequencing show the successful introduction of the risk allele at rs2435357 in the UE-rs2435357 hPSC line. (C) Differentiation strategy to generate human neural crest (hNC) and neuronal progenitor (hNP). HU is encoded by the ELAVL4 gene. Immunostaining of SOX10 and TUJ1 in hNC and hNP of the control and the mutant (UE-rs2435357) lines. Scale bars: (hNC) 100 μm; (hNP) 200 μm. RT-qPCR analysis showing the comparable ELAVL4 expression level in hNP in the control (n = 5) and the mutant (UE-rs2435357) (n = 3) lines. t-test, (ns) not significant. (D) RT-qPCR analysis showing RET expression in the hPSC and hNP stages of the control (n = 5) and the mutant (UE-rs2435357) (n = 3). t-test, (ns) not significant. (E) Hi-C data from neural progenitor cells show that the enhancer in intron 1 of RASGEF1A (marked in yellow on the right) has physical interaction with the promoter of RET (marked in yellow on the left) at 10-kbp bin size. (F) ATAC-seq and ChIP-seq data from hPSC and hNC at the RASGEF1A intron 1 locus. (G) The design of sgRNAs used for the CRISPR-Cas9 system for deleting the DNA fragment in RASGEF1A intron 1. Genotyping reveals the specific deletion of RASGEF1A intron 1 in the UE-RASGEF1A-int1-KO hPSC line. (WT) Wild type, (KO) knockout. (H) Immunostaining of SOX10, TUJ1, and HU in hNC and hNP of the control and the mutant (RASGEF1A-int1-KO) lines, respectively. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (I) RT-qPCR reveals the expression level of RET in the hPSC and hNP stages of the control (n = 4–5) and the mutant (RASGEF1A-int1-KO) (n = 6–7). t-test, (ns) not significant.

Journal: Genome Research

Article Title: Whole-genome analysis of noncoding genetic variations identifies multiscale regulatory element perturbations associated with Hirschsprung disease

doi: 10.1101/gr.264473.120

Figure Lengend Snippet: Functional impacts of a HSCR-associated SNP (rs2435357) and the deletion of a novel S-HSCR enhancer on RET expression. (A) ATAC-seq and ChIP-seq profiles of hPSC and hNC in intron 1 of RET show that rs2435357 is residing in a hNC-specific ATAC-seq peak. (B) Location of rs2435357 in the RET gene locus and in the sgRNA used for CRISPR-Cas9-mediated HDR for editing the C allele to the HSCR-associated risk allele T. The electrographs of Sanger sequencing show the successful introduction of the risk allele at rs2435357 in the UE-rs2435357 hPSC line. (C) Differentiation strategy to generate human neural crest (hNC) and neuronal progenitor (hNP). HU is encoded by the ELAVL4 gene. Immunostaining of SOX10 and TUJ1 in hNC and hNP of the control and the mutant (UE-rs2435357) lines. Scale bars: (hNC) 100 μm; (hNP) 200 μm. RT-qPCR analysis showing the comparable ELAVL4 expression level in hNP in the control (n = 5) and the mutant (UE-rs2435357) (n = 3) lines. t-test, (ns) not significant. (D) RT-qPCR analysis showing RET expression in the hPSC and hNP stages of the control (n = 5) and the mutant (UE-rs2435357) (n = 3). t-test, (ns) not significant. (E) Hi-C data from neural progenitor cells show that the enhancer in intron 1 of RASGEF1A (marked in yellow on the right) has physical interaction with the promoter of RET (marked in yellow on the left) at 10-kbp bin size. (F) ATAC-seq and ChIP-seq data from hPSC and hNC at the RASGEF1A intron 1 locus. (G) The design of sgRNAs used for the CRISPR-Cas9 system for deleting the DNA fragment in RASGEF1A intron 1. Genotyping reveals the specific deletion of RASGEF1A intron 1 in the UE-RASGEF1A-int1-KO hPSC line. (WT) Wild type, (KO) knockout. (H) Immunostaining of SOX10, TUJ1, and HU in hNC and hNP of the control and the mutant (RASGEF1A-int1-KO) lines, respectively. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (I) RT-qPCR reveals the expression level of RET in the hPSC and hNP stages of the control (n = 4–5) and the mutant (RASGEF1A-int1-KO) (n = 6–7). t-test, (ns) not significant.

Article Snippet: Plasmid constructions Human codon-optimized high fidelity Cas9 nuclease construct ( Ran et al. 2013 ) was obtained from Addgene (48138).

Techniques: Functional Assay, Expressing, ChIP-sequencing, CRISPR, Sequencing, Immunostaining, Control, Mutagenesis, Quantitative RT-PCR, Hi-C, Knock-Out

Characterization of a novel S-HSCR-associated regulatory element in intron 10 of PIK3C2B. (A) Overview of ATAC-seq and ChIP-seq profiles showing the putative hNC-specific regulatory element in PIK3C2B intron 10. The red shaded region indicates the location of the regulatory element and the line shows the A > T variant (rs551359143) found exclusively in the S-HSCR cases that disrupts the NFIA binding motif. The motif is not drawn to the same scale as the genomic signal tracks, with magnified characters. (B) Design of sgRNAs used for the CRISPR-Cas9 system for deleting the regulatory element. Genotyping reveals the specific deletion of the 171-bp fragment in intron 10 of PIK3C2B in the PIK3C2B-int10-KO hPSC line. (WT) Wild type, (KO) knockout. (C) Immunostaining shows that both the control and mutant (PIK3C2B-int1-KO) lines have comparable capability to make hNCs and hNPs. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (D) RT-qPCR shows the changes in the expression of PIK3CB in different cell stages in the control and mutant lines. t-test, (ns) not significant. n = 3–4 per group. (E) Design of the constructs used for the luciferase assay. The bar chart shows the relative luciferase activities when the cells were transfected with different sets of constructs as indicated. Three independent assays were performed, each in triplicate. One-way ANOVA. (F) Gel mobility shift assays were performed with biotin-labeled probes containing the PIK3C2B intron 10 regulatory element with or without the A > T conversion and the nuclear extract from NFIA-overexpressing cells, in the presence of unlabeled probes or anti-NFIA antibody (0.1 µg). (G) Significant contacts (FDR < 0.05) in the promoter capture Hi-C data from GM12878 cells at the PIK3C2B locus. The putative regulatory element in intron 10 of PIK3C2B is marked in yellow. Contacts between the regulatory element and the TSSs of SOX13, PPP1R15B, and PIK3C2B are shown in purple curves, while contacts between the regulatory element and other promoters are shown in gray curves. Contacts that extend too far are trimmed. (H) RT-qPCR analysis shows the changes in the expression of PPP1R15B and SOX13 in the control and the mutant lines at different cell stages. t-test, (ns) not significant. n = 3–4 per group.

Journal: Genome Research

Article Title: Whole-genome analysis of noncoding genetic variations identifies multiscale regulatory element perturbations associated with Hirschsprung disease

doi: 10.1101/gr.264473.120

Figure Lengend Snippet: Characterization of a novel S-HSCR-associated regulatory element in intron 10 of PIK3C2B. (A) Overview of ATAC-seq and ChIP-seq profiles showing the putative hNC-specific regulatory element in PIK3C2B intron 10. The red shaded region indicates the location of the regulatory element and the line shows the A > T variant (rs551359143) found exclusively in the S-HSCR cases that disrupts the NFIA binding motif. The motif is not drawn to the same scale as the genomic signal tracks, with magnified characters. (B) Design of sgRNAs used for the CRISPR-Cas9 system for deleting the regulatory element. Genotyping reveals the specific deletion of the 171-bp fragment in intron 10 of PIK3C2B in the PIK3C2B-int10-KO hPSC line. (WT) Wild type, (KO) knockout. (C) Immunostaining shows that both the control and mutant (PIK3C2B-int1-KO) lines have comparable capability to make hNCs and hNPs. Scale bars: (hNC) 100 μm; (hNP) 200 μm. (D) RT-qPCR shows the changes in the expression of PIK3CB in different cell stages in the control and mutant lines. t-test, (ns) not significant. n = 3–4 per group. (E) Design of the constructs used for the luciferase assay. The bar chart shows the relative luciferase activities when the cells were transfected with different sets of constructs as indicated. Three independent assays were performed, each in triplicate. One-way ANOVA. (F) Gel mobility shift assays were performed with biotin-labeled probes containing the PIK3C2B intron 10 regulatory element with or without the A > T conversion and the nuclear extract from NFIA-overexpressing cells, in the presence of unlabeled probes or anti-NFIA antibody (0.1 µg). (G) Significant contacts (FDR < 0.05) in the promoter capture Hi-C data from GM12878 cells at the PIK3C2B locus. The putative regulatory element in intron 10 of PIK3C2B is marked in yellow. Contacts between the regulatory element and the TSSs of SOX13, PPP1R15B, and PIK3C2B are shown in purple curves, while contacts between the regulatory element and other promoters are shown in gray curves. Contacts that extend too far are trimmed. (H) RT-qPCR analysis shows the changes in the expression of PPP1R15B and SOX13 in the control and the mutant lines at different cell stages. t-test, (ns) not significant. n = 3–4 per group.

Article Snippet: Plasmid constructions Human codon-optimized high fidelity Cas9 nuclease construct ( Ran et al. 2013 ) was obtained from Addgene (48138).

Techniques: ChIP-sequencing, Variant Assay, Binding Assay, CRISPR, Knock-Out, Immunostaining, Control, Mutagenesis, Quantitative RT-PCR, Expressing, Construct, Luciferase, Transfection, Mobility Shift, Labeling, Hi-C